View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_66 (Length: 324)
Name: NF0784_low_66
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 103 - 288
Target Start/End: Complemental strand, 44619565 - 44619380
Alignment:
Q |
103 |
aaaagatcgccgctttcaatccatgaaacatatgatataatactttttgtccttgttatagttttagtcttatagtattttatctattttggaattaatc |
202 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
44619565 |
aaaagatcgccgttttcaatccatgaaacatatgatataatattttttgtccttgttttagttttagtcttgtagtattttatctattttggaattaatc |
44619466 |
T |
 |
Q |
203 |
tttctaatatggggaccatgtttatttaaatctctggaatctggcattttgtgatgatctaattgaaagtatattctctttgtcag |
288 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
44619465 |
tttctaatatggggaccatgtttatttaaatctctggaatctggcatcttgtgatgatctaattgaaagtatattctctttgtcag |
44619380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University