View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_70 (Length: 319)
Name: NF0784_low_70
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_70 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 97 - 240
Target Start/End: Complemental strand, 28347440 - 28347296
Alignment:
| Q |
97 |
aacatgcaccttcttatctcaatggttatgtttgtcctacatgacaaaacattcatactacttcatcccatcataaatattctattca-nnnnnnngtca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28347440 |
aacatgcaccttcttatctcaatggttatgtttgtcctacatcacaaaacattcatactacttcatcccatcataaatattctattcatattttttgtca |
28347341 |
T |
|
| Q |
196 |
tatgatgataatttatctaatgctcaccctcgttttgttgtctct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28347340 |
tatgatgataatttatctaatgctcaccctcgttttgttgtctct |
28347296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6860 times since January 2019
Visitors: 5772