View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_71 (Length: 319)
Name: NF0784_low_71
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_71 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 97 - 319
Target Start/End: Complemental strand, 28347440 - 28347218
Alignment:
Q |
97 |
aacatgcaccttcttatctcaatggttatgtttgtcctacatgacaaaacattcatactacttcatcccatcataaatattctattcannnnnnnngtca |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
28347440 |
aacatgcaccttcttatctcaatggttatgtttgtcctacatcacaaaacattcatactacttcatcccatcataaatattctattcatattttttgtca |
28347341 |
T |
 |
Q |
197 |
tatgatgataatttatctaatgctcaccctcgttttgttgtctcttcatgatcatcctgaactcaaatcttttacttaggcaaacatgatcacgatgatc |
296 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
28347340 |
tatgatgataatttatctaatgctcaccctcgttttgttgtctcttcattatcatcctgaactcaaatcttttacttaggcaaacatgatcacaatgatc |
28347241 |
T |
 |
Q |
297 |
cttattcaaatattccagcttat |
319 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
28347240 |
cttattcaaatattccagcttat |
28347218 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University