View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_72 (Length: 319)
Name: NF0784_low_72
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 149 - 259
Target Start/End: Complemental strand, 43665194 - 43665084
Alignment:
| Q |
149 |
gtaaatgagaaatcattggttcacgataattttatttgactattttacacaatttaaaaaatatgtatatatttgtatnnnnnnnngcgaataaaataaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43665194 |
gtaaatgagaaatcattggttcacgataattttatttgactattttacacaatttaaaaaatatgtatatatttgtataaaaaaaagcgaataaaataaa |
43665095 |
T |
 |
| Q |
249 |
tgagagatgag |
259 |
Q |
| |
|
||||||||||| |
|
|
| T |
43665094 |
tgagagatgag |
43665084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 93 - 129
Target Start/End: Complemental strand, 43665257 - 43665221
Alignment:
| Q |
93 |
cacctactgtgatttcaaacatagtattaatcatttc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665257 |
cacctactgtgatttcaaacatagtattaatcatttc |
43665221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University