View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_80 (Length: 306)
Name: NF0784_low_80
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_80 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 102 - 155
Target Start/End: Original strand, 4580273 - 4580326
Alignment:
Q |
102 |
attccatcttgatgtttgatcattatcaggtttagggggtgtgttatattgaag |
155 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
T |
4580273 |
attccatcttgatgtttgatcattataaggtttaggggatgtgttatattgaag |
4580326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 4580345 - 4580391
Alignment:
Q |
178 |
aaggaatgttatattgaagtttttgatactgtatttgatattattgg |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
4580345 |
aaggaatgttatattgaagtttttgatactgtatttgatatttttgg |
4580391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University