View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_low_80 (Length: 306)

Name: NF0784_low_80
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_low_80
NF0784_low_80
[»] chr8 (2 HSPs)
chr8 (102-155)||(4580273-4580326)
chr8 (178-224)||(4580345-4580391)


Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 102 - 155
Target Start/End: Original strand, 4580273 - 4580326
Alignment:
102 attccatcttgatgtttgatcattatcaggtttagggggtgtgttatattgaag 155  Q
    |||||||||||||||||||||||||| ||||||||||| |||||||||||||||    
4580273 attccatcttgatgtttgatcattataaggtttaggggatgtgttatattgaag 4580326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 4580345 - 4580391
Alignment:
178 aaggaatgttatattgaagtttttgatactgtatttgatattattgg 224  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||    
4580345 aaggaatgttatattgaagtttttgatactgtatttgatatttttgg 4580391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University