View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_85 (Length: 297)
Name: NF0784_low_85
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_85 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 85 - 278
Target Start/End: Complemental strand, 29809178 - 29808985
Alignment:
Q |
85 |
tattcttttgcaagacactactatcctttatttgccctatttaagacaagctagttgcatgtgtattt-cacttcaaattctacactatagttctcnnnn |
183 |
Q |
|
|
||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
T |
29809178 |
tattcttttgcaagacactactaccctttatt-gccctatttaaggcaagctagttgcatgtgtattttcacttaaaattctacactatagttctctttt |
29809080 |
T |
 |
Q |
184 |
nnncttacaagttatcatggctcgttcagttcctttggtttccaccatctttgtcttccttctgcttcttgtggccactggtgagtagtgtttct |
278 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29809079 |
tttcttacaagttatcatggctcgttcagttcctttggtttccaccatctttgtcttccttctgcttcttgtggccactggtgagtagtgtttct |
29808985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 200 - 266
Target Start/End: Complemental strand, 29801720 - 29801654
Alignment:
Q |
200 |
atggctcgttcagttcctttggtttccaccatctttgtcttccttctgcttcttgtggccactggtg |
266 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||| || |||| ||||||||||||||||||| |
|
|
T |
29801720 |
atggctcgttcacttcctttggtttccaccatctttgttttttttcttcttcttgtggccactggtg |
29801654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 200 - 266
Target Start/End: Complemental strand, 29804838 - 29804772
Alignment:
Q |
200 |
atggctcgttcagttcctttggtttccaccatctttgtcttccttctgcttcttgtggccactggtg |
266 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||| |||| ||| ||||||||||||||| |
|
|
T |
29804838 |
atggctcgttcagtgtctttggtttccaccatctttgtcttttttcttcttattgtggccactggtg |
29804772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6161 times since January 2019
Visitors: 5762