View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_87 (Length: 293)
Name: NF0784_low_87
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_87 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 36919086 - 36919016
Alignment:
| Q |
1 |
gaaatatctcctctaattctatggtcaaaaacattaattataattgaagatcaatttcatttttccacctaattc |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36919086 |
gaaatatctcctctaattctatggtcaaaaacatta----taattgaagatcaatttcatttttccacctaattc |
36919016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 36918881 - 36918826
Alignment:
| Q |
155 |
agaagttttaatttttaagtatatgaaatttgtcactttaatttagttcatactct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36918881 |
agaagttttaatttttaagtatatgaaatttgtcactttaatttagtccatactct |
36918826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 83 - 119
Target Start/End: Complemental strand, 36918953 - 36918917
Alignment:
| Q |
83 |
ggctctctcaaatatcactctttccaacttaaatcct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36918953 |
ggctctctcaaatatcactctttccaacttaaatcct |
36918917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7054 times since January 2019
Visitors: 5773