View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_9 (Length: 567)
Name: NF0784_low_9
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 469; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 469; E-Value: 0
Query Start/End: Original strand, 30 - 514
Target Start/End: Complemental strand, 45626183 - 45625699
Alignment:
| Q |
30 |
gactatactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagttggagtgtcttcaaattt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45626183 |
gactatactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagttgcagtgtcttcaaattt |
45626084 |
T |
 |
| Q |
130 |
aaaagtgtcgaggagatcagagcaggatgcatcatgttccccttcttcagtcagaagctcaagacccaactcatcttcaatatggtcagaagcagatatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45626083 |
aaaagtgtcgaggagatcagagcaggatgcatcatgctccccttcttcagtcagaagctcaagacccaactcatcttcaatatggtcagaagcagatatg |
45625984 |
T |
 |
| Q |
230 |
agcaaaaactcgcatccttcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtccttgcaggtgagccgggaacaccg |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45625983 |
agcaaaaactcgcatccttcatagtttagaaagtctggtgggtcagctggggcgaatctgacatgacctaattgtccttgcaggtgagccgggaacatcg |
45625884 |
T |
 |
| Q |
330 |
ccttgcgtttcttttgcaaaccacctccacctgcaccaactttttcttcagggttctttatttgaattatgaacgatccctcacgttcaatgttgagtgc |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45625883 |
ccttgcgtttcttttgcaaaccacctccacctgcaccaactttttcttcagggttctttatttgaattatgaacgatccctcacgttcaatgttgattgc |
45625784 |
T |
 |
| Q |
430 |
ttcctggggttcattcttctcatcttcacctggaaattctaacttgtagattaaatgggtgtggcttcttttcccactctctgct |
514 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625783 |
ttcctggggttcattcttctcatcttcacctggaaattctaacttgtagattaaatgggtgtggcttcttttcccactctctgct |
45625699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University