View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_94 (Length: 284)
Name: NF0784_low_94
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_94 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 25 - 272
Target Start/End: Original strand, 28606982 - 28607229
Alignment:
Q |
25 |
atccgtttgataaggattcaagtcatattgttcacttgcatcatccgtttaaatttatatgttgatatattatttaactatatgtcaataaaattcgaat |
124 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28606982 |
atccgtttgataaggattcaagtcatattgttcacttgcatcatccgtttaaatttatatgttgatatattatttaactatatgtcaataaaattcgaat |
28607081 |
T |
 |
Q |
125 |
aatctgataaaatatgtaaaccacacttaattatttggattaatttggtaggatgctttttagaaaagcaatcgtcacacccagctaaaatgcatgatca |
224 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28607082 |
aatcttataaaatatgtaaaccacacttaattatttggattaatttggtaggatgctttttagaaaagcaatcgtcacacccagctaaaatgcatgatca |
28607181 |
T |
 |
Q |
225 |
agattttgtgcaagaaatacaagctttcaatttactcaagtttatatt |
272 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
28607182 |
agatattgtgcaagaaatacaagctttcaatttactcaaatttatatt |
28607229 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University