View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0786_high_20 (Length: 252)
Name: NF0786_high_20
Description: NF0786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0786_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 93 - 242
Target Start/End: Original strand, 45312279 - 45312428
Alignment:
| Q |
93 |
tttccgacatgaatcatgaagtgacaaatcgagtatcaatgggatctaaaattgggcatgaggaagttcggtgttgcatacttattttgtttgctatatt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45312279 |
tttccgacatgaatcatgaagtgacaaatcgagtatcaatgggatctaaaattgggcatgaggaagttcggtgttgcatacttattttgtttgctatatt |
45312378 |
T |
 |
| Q |
193 |
tgttatcaaggttggcctacaaaaatacagtcttaattgaaacagtataa |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45312379 |
tgttatcaaggttggcctacaaaaatacagtcttaattgaaacagtataa |
45312428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 45312188 - 45312252
Alignment:
| Q |
1 |
catactattaattataaattctgtgatgagtgaccaccgattgtaataagcagcagctggaacag |
65 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45312188 |
catactattaattataaattctgtgatgggtgaccactgattgtaataagcagcagctggaacag |
45312252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University