View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0786_high_23 (Length: 246)
Name: NF0786_high_23
Description: NF0786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0786_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 46 - 210
Target Start/End: Complemental strand, 521473 - 521309
Alignment:
Q |
46 |
catcacaaacacaagccccttatcaaaacccaatcccaaacaagtccttcacaacaaagcaaatcttgtcacttcactttacatagcacataatattgct |
145 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
521473 |
catcacaaacacaagctccttatcaaaacccaatcccaaacaagtccttcacaacaaagcaaatcctgtcacttcactttacatagcacataatattgct |
521374 |
T |
 |
Q |
146 |
gtctagttatcacaactaaaagggagtgcaaataacaatttcgctaactacaaaaccaattcaca |
210 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
521373 |
gtttagttatcacaactaaaagggagtgcaaataacaacttcgctaactacaaaaccaattcaca |
521309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University