View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0786_low_22 (Length: 301)
Name: NF0786_low_22
Description: NF0786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0786_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 46873789 - 46873518
Alignment:
| Q |
1 |
cggtcaataccgtaccggcttcggcgctatactttccgccggtgctttcgtctctgctcttgttgtcggctttgtcgcgatctactcagctccttttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873789 |
cggtcaataccgtaccggcttcggcgctatactttccgccggtgctttcgtctctgctcttgttgtcggctttgtcgcgatctactcagctccttttccc |
46873690 |
T |
 |
| Q |
101 |
gttgatccggcgccgtttgttagagatgtgttgttctacttaactgctgctatgtttctgttttatgtttatcttagtgctgagatttttctatggcaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873689 |
gttgatccggcgccgtttgttagagatgttttgttctacttaactgctgctatgtttctgttttatgtttatcttagtgctgagatttttctatggcaag |
46873590 |
T |
 |
| Q |
201 |
ccgttggattcgttgcgttctatcttttctttgttggttttgtgttctacatggatttgggaatggccaatc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873589 |
ccgttggattcgttgcgttctatcttttctttgttgtttttgtgttctacatggatttgggaatggccaatc |
46873518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University