View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0786_low_28 (Length: 269)
Name: NF0786_low_28
Description: NF0786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0786_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 2 - 241
Target Start/End: Original strand, 30195935 - 30196178
Alignment:
Q |
2 |
ctgatgatcataatatatggggtttctagttaggtctatcttaatatttagggtttccaaaagttttgtaaaagataaaatattagcttatgagattaaa |
101 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30195935 |
ctgatgatcataatatgtggggtttctagttaggtctatcttaatatttagggtttccaaaagttttgtaaaagataaaatattagcttatgagattaaa |
30196034 |
T |
 |
Q |
102 |
gaccatgcactgtcaatgcaattgcaacttctcaatgcttcaaataattaaaaatcgaaagttgtgattgattgttggtgtaaaataattttacattgaa |
201 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30196035 |
gaccatgcactctcaatgcaattgcaacttctcaatgcttcaaatgattaaaaatcgaaagttgtgattgattgttggtgtaaaataattttacattgaa |
30196134 |
T |
 |
Q |
202 |
gctaaattaagaatcctgatg----agttaatcctcttgtactt |
241 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
30196135 |
gctaaattaagaatcctgatgagttagttaatcctcttgtactt |
30196178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 163 - 196
Target Start/End: Complemental strand, 13634689 - 13634656
Alignment:
Q |
163 |
ttgtgattgattgttggtgtaaaataattttaca |
196 |
Q |
|
|
||||||||||||||| |||||||||||||||||| |
|
|
T |
13634689 |
ttgtgattgattgttagtgtaaaataattttaca |
13634656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 157 times since January 2019
Visitors: 5777