View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0786_low_32 (Length: 257)
Name: NF0786_low_32
Description: NF0786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0786_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 12699015 - 12699243
Alignment:
| Q |
4 |
tgattttattgatatattcggaccttaannnnnnnaaaatttgtcgtattcttgtattgctatctgtattatatcgggtaccgtatccatnnnnnnnnnn |
103 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12699015 |
tgattttattgatatattcggaccttagtttttttaaaatttgtcgtattcttgtattgctatctgtattatatcgggtaccgtatccataaaaaaaata |
12699114 |
T |
 |
| Q |
104 |
n-tttatatgtacattaataaatatatatc--------tatatgtacatttttcttatatctnnnnnnntaaaatttctcttatatatttatgcggtgta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12699115 |
tatttatatgtacattaataaatatatatccatatatctatatgtacatttttcttatatctaaaaaaataaaatttctcttatatatttatgcggtgta |
12699214 |
T |
 |
| Q |
195 |
tttgggtattagaatgctacccataccat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
12699215 |
attgggtattagaatgctacccataccat |
12699243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University