View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0786_low_33 (Length: 255)
Name: NF0786_low_33
Description: NF0786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0786_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 33123404 - 33123187
Alignment:
Q |
14 |
aataatataaacgggacttatttttacacttgtacacgttacaaaattatgtt-acttgttactactattagacaaagtctaatttcatatactgttttc |
112 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33123404 |
aataagataaacgggacttatttttacacttgtacacgttacaaaattatgtttacttgttactactattagacaaagtctaatttcatatactgttttc |
33123305 |
T |
 |
Q |
113 |
aggttgactttttgtctgcatgaaaaatgtatatcttagaaaccacatttttcaccatccatcacaattcatatactacnnnnnnnncttcatatatatt |
212 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
33123304 |
aggttgactttttgtctgcatgaaaaatgtatatcttagaaaccacatttttcaccatccatcacaattcatatactacttttttttcttcatatatatt |
33123205 |
T |
 |
Q |
213 |
gaatttagttaacatttg |
230 |
Q |
|
|
||||| |||||||||||| |
|
|
T |
33123204 |
gaattaagttaacatttg |
33123187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6502 times since January 2019
Visitors: 5768