View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0786_low_34 (Length: 252)

Name: NF0786_low_34
Description: NF0786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0786_low_34
NF0786_low_34
[»] chr8 (2 HSPs)
chr8 (93-242)||(45312279-45312428)
chr8 (1-65)||(45312188-45312252)


Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 93 - 242
Target Start/End: Original strand, 45312279 - 45312428
Alignment:
93 tttccgacatgaatcatgaagtgacaaatcgagtatcaatgggatctaaaattgggcatgaggaagttcggtgttgcatacttattttgtttgctatatt 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45312279 tttccgacatgaatcatgaagtgacaaatcgagtatcaatgggatctaaaattgggcatgaggaagttcggtgttgcatacttattttgtttgctatatt 45312378  T
193 tgttatcaaggttggcctacaaaaatacagtcttaattgaaacagtataa 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
45312379 tgttatcaaggttggcctacaaaaatacagtcttaattgaaacagtataa 45312428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 45312188 - 45312252
Alignment:
1 catactattaattataaattctgtgatgagtgaccaccgattgtaataagcagcagctggaacag 65  Q
    |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||    
45312188 catactattaattataaattctgtgatgggtgaccactgattgtaataagcagcagctggaacag 45312252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University