View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0786_low_38 (Length: 247)

Name: NF0786_low_38
Description: NF0786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0786_low_38
NF0786_low_38
[»] chr5 (2 HSPs)
chr5 (46-123)||(9180539-9180616)
chr5 (199-243)||(9180692-9180736)


Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 46 - 123
Target Start/End: Original strand, 9180539 - 9180616
Alignment:
46 tgataagatctcgtttctccatgcaaccgatcaccggcgctaccaccaccatcacggccgatcacacaaatgccgcca 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9180539 tgataagatctcgtttctccatgcaaccgatcaccggcgctaccaccaccatcacggccgatcacacaaatgccgcca 9180616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 199 - 243
Target Start/End: Original strand, 9180692 - 9180736
Alignment:
199 gcttccataaacccagatcctttcttatttcatgtaattcctctc 243  Q
    |||||||||||||||||||||||||||||||||||||||| ||||    
9180692 gcttccataaacccagatcctttcttatttcatgtaattcatctc 9180736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University