View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0786_low_38 (Length: 247)
Name: NF0786_low_38
Description: NF0786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0786_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 46 - 123
Target Start/End: Original strand, 9180539 - 9180616
Alignment:
Q |
46 |
tgataagatctcgtttctccatgcaaccgatcaccggcgctaccaccaccatcacggccgatcacacaaatgccgcca |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9180539 |
tgataagatctcgtttctccatgcaaccgatcaccggcgctaccaccaccatcacggccgatcacacaaatgccgcca |
9180616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 199 - 243
Target Start/End: Original strand, 9180692 - 9180736
Alignment:
Q |
199 |
gcttccataaacccagatcctttcttatttcatgtaattcctctc |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
9180692 |
gcttccataaacccagatcctttcttatttcatgtaattcatctc |
9180736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University