View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0787_high_21 (Length: 240)
Name: NF0787_high_21
Description: NF0787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0787_high_21 |
 | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 3765 - 3971
Alignment:
| Q |
16 |
agagaaaagaaggttttacacaggtgacatatacccagatgcatattttatttggtgcgttttgaagttatctttcattattttcacagccgaatctttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3765 |
agagaaaagaaggttttacacaggtgacaaatacccagatgcatattttatttggtgcgttttgaagttatctttcattattttcacagctgaatctttt |
3864 |
T |
|
| Q |
116 |
atttcgtgtcattgtttcacttattttggtggctaggagatgaaggttttacacagttgacattatatatcgttgaaagtttttatcatacacactcttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3865 |
atttcgtgtcattgtttcacttattttggtggctaggagatgaaggttttacacagttgacattatatatcgttgaaagtttttatcatacacactcttc |
3964 |
T |
|
| Q |
216 |
aaacttc |
222 |
Q |
| |
|
||||||| |
|
|
| T |
3965 |
aaacttc |
3971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10 times since January 2019
Visitors: 5776