View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0787_high_22 (Length: 235)
Name: NF0787_high_22
Description: NF0787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0787_high_22 |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0179 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 24 - 224
Target Start/End: Complemental strand, 3971 - 3771
Alignment:
| Q |
24 |
gaagtttgaagagtgtgtatgataaaaactttcaacgatatataatgtcaactgtgtaaaaccttcatctcctagccaccaaaataagtgaaacaatgac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3971 |
gaagtttgaagagtgtgtatgataaaaactttcaacgatatataatgtcaactgtgtaaaaccttcatctcctagccaccaaaataagtgaaacaatgac |
3872 |
T |
 |
| Q |
124 |
acgaaataaaagattcggctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatctgggtatatgtcacctgtgtaaaaccttct |
223 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3871 |
acgaaataaaagattcagctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatctgggtatttgtcacctgtgtaaaaccttct |
3772 |
T |
 |
| Q |
224 |
t |
224 |
Q |
| |
|
| |
|
|
| T |
3771 |
t |
3771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University