View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0787_low_24 (Length: 263)
Name: NF0787_low_24
Description: NF0787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0787_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 2 - 234
Target Start/End: Complemental strand, 47636430 - 47636198
Alignment:
Q |
2 |
ataaattttctattcataagactatgatccccgataaaagtaaaccagtttaatgaaacagaaatttgacaaaagaattcaattgcacagttttctcatg |
101 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
47636430 |
ataaattttctattcataagactatgatccccgataaaagtaaaccagtttaatgaaacagaaatttgacaaaagaattcaattgtacagttttctcatg |
47636331 |
T |
 |
Q |
102 |
tgaagtgtgcactataaagagttcagataagatgcacctaccaaaaagaatatagtcgaggcttttgttggccacaaattcataaacaagtatcttttct |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47636330 |
tgaagtgtgcactataaagagttcagataagatgcacctaccaaaaagaatatagtcgaggcttttgttggccacaaattcataaacaagtatcttttct |
47636231 |
T |
 |
Q |
202 |
tctctttccaagcaaaatcctagaagcctagct |
234 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
47636230 |
tctctttccaagcaaaatcctagaagcctagct |
47636198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5482 times since January 2019
Visitors: 5757