View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0787_low_28 (Length: 251)

Name: NF0787_low_28
Description: NF0787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0787_low_28
NF0787_low_28
[»] chr1 (1 HSPs)
chr1 (1-234)||(6088626-6088859)
[»] chr3 (1 HSPs)
chr3 (2-135)||(46678056-46678189)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 6088859 - 6088626
Alignment:
1 caaaatgcaggatgatacattgacaggaatagattcttcagttgacattgctacagaggagaacttgaagaaactgtgccaaattggcgagaacttgtta 100  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || || |||    
6088859 caaaatgcaggatgatacattgacaggaatcgattcttcagttgacattgctacagaggagaacttgaagaaactgtgccaaattggtgaaaatttatta 6088760  T
101 aagaaaccggtctctagagtcaatttggaaaatggccactttgagccactgacaaatggagaaaccaatgaagatgctctcaagaggtaattaagattaa 200  Q
    |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||    
6088759 aagaaaccggtctctagagtcaatttagaaaatggtcactttgagccactgacaaatggagaaaccaatgaagaagctctcaagaggtaattaagataaa 6088660  T
201 ccagtagtgatggtacattttaattaccactcaa 234  Q
      ||||| || |||||||||||||||||||||||    
6088659 ttagtagagacggtacattttaattaccactcaa 6088626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 135
Target Start/End: Original strand, 46678056 - 46678189
Alignment:
2 aaaatgcaggatgatacattgacaggaatagattcttcagttgacattgctacagaggagaacttgaagaaactgtgccaaattggcgagaacttgttaa 101  Q
    ||||||||||||||||||||||| || | ||||||||| ||||| ||| | ||| | ||||| ||  | ||||| ||||||||||| || |  ||||| |    
46678056 aaaatgcaggatgatacattgaccggtacagattcttcggttgatatttccacaaaagagaatttagaaaaactttgccaaattggtgacagattgttga 46678155  T
102 agaaaccggtctctagagtcaatttggaaaatgg 135  Q
    ||||||| || ||||  |||||||| || |||||    
46678156 agaaaccagtatctaaggtcaatttagagaatgg 46678189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University