View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0787_low_30 (Length: 235)

Name: NF0787_low_30
Description: NF0787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0787_low_30
NF0787_low_30
[»] scaffold0179 (1 HSPs)
scaffold0179 (24-224)||(3771-3971)


Alignment Details
Target: scaffold0179 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 24 - 224
Target Start/End: Complemental strand, 3971 - 3771
Alignment:
24 gaagtttgaagagtgtgtatgataaaaactttcaacgatatataatgtcaactgtgtaaaaccttcatctcctagccaccaaaataagtgaaacaatgac 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3971 gaagtttgaagagtgtgtatgataaaaactttcaacgatatataatgtcaactgtgtaaaaccttcatctcctagccaccaaaataagtgaaacaatgac 3872  T
124 acgaaataaaagattcggctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatctgggtatatgtcacctgtgtaaaaccttct 223  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
3871 acgaaataaaagattcagctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatctgggtatttgtcacctgtgtaaaaccttct 3772  T
224 t 224  Q
    |    
3771 t 3771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University