View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0787_low_36 (Length: 214)
Name: NF0787_low_36
Description: NF0787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0787_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 7934623 - 7934497
Alignment:
Q |
1 |
tctatggcacatattgtaacaatggaatgaaagaataacgaacaaaatattatgtatttttcatgagaaatattacataatacacaggaaaaaatggaac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7934623 |
tctatggcacatattgtaacaatggaatgaaagaataatgaacaaaatattatgtatttttcatgagaaatattacataatacacaggaaaaaatggaac |
7934524 |
T |
 |
Q |
101 |
aggggttaccaaatgtggtgctgatga |
127 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
7934523 |
aggggttaccaaatgtggtgctgatga |
7934497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University