View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0787_low_37 (Length: 202)
Name: NF0787_low_37
Description: NF0787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0787_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 13034686 - 13034561
Alignment:
Q |
1 |
agttttgggacatgtacatataannnnnnnngtctaatatcgatcaaatcactatcttagacggtacaatgatttgtgaacttctacttagaagaacggt |
100 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13034686 |
agttttgggacatgtacatataattttttt-gtctaatatcgatcaaatcactatcttagacggtacaatgatttgtgaacttctacttagaagaacggt |
13034588 |
T |
 |
Q |
101 |
gtcggtaattgaataattatattgttg |
127 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
13034587 |
gtcggtaattgaataattatattgttg |
13034561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5441 times since January 2019
Visitors: 5757