View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0787_low_7 (Length: 452)
Name: NF0787_low_7
Description: NF0787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0787_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 164 - 423
Target Start/End: Original strand, 43340325 - 43340579
Alignment:
Q |
164 |
accctacaaaggtagagggagtgataataacaaaggatttgtgatctagctttgttttgc-tttaagtctttttatttgcacgcttagagggtcctattt |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
T |
43340325 |
accctacaaaggtagagggagtgataataacaaaggatttgtgatctagctttgttttgcttttaagtctttttatttgcacgcttagagggtccta--t |
43340422 |
T |
 |
Q |
263 |
attctctctctcatctttataataaagggagagatnnnnnnnnnnnnnnttgagtggt-nnnnnnnctatggagagagagattccaaagcaactcaactc |
361 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
T |
43340423 |
attctctctctcctctttataataaagggagagat--aaaaaaaaaaaattgagtggtaaaaaaaactatg--gagagagattccaaagcaactcaactc |
43340518 |
T |
 |
Q |
362 |
aagtccctaaaaacagaaaataagaacataaataaagcacgcaaccaaaattacctgtggct |
423 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
43340519 |
aagtccctaaaaacagaaaataagaacataaataaagcacgcaacc-aaattacctgtggct |
43340579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 43340163 - 43340243
Alignment:
Q |
1 |
tatgtgaggtagctaggtttgaagtgtgcgagagacaatagacaatgaaccttaagcggtacttttggtcactggagaaag |
81 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43340163 |
tatgtgaggtagctaggtttgaagtgtgcgagagacaatagacaatgaaccttaagcggtacttttggtcactggagaaag |
43340243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5839 times since January 2019
Visitors: 5759