View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0788_high_4 (Length: 415)
Name: NF0788_high_4
Description: NF0788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0788_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 58 - 413
Target Start/End: Original strand, 28275254 - 28275609
Alignment:
| Q |
58 |
caacaacaatatcttgattagtatcttactcgcatcattctactaagcaggagatagatatactcttataacgaggaattacgtcaatatttgaacgcat |
157 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275254 |
caacaacaatgtcttgattagtatcttgctcgcatcattctactaagcaggagatagatatactcttataacgaggaattacgtcaatatttgaacgcat |
28275353 |
T |
|
| Q |
158 |
gtaaagatcaaaggactaatgttggtatggcatacaactttgtggtccacttggagggcctgttttgacttcattttttctggggtggtaccaaaagtgg |
257 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275354 |
gtaaagatcaagggactaatgttggtatggcatacaactttgtggtccatttggagggcgtgttttgacttcattttttctggggtggtaccaaaagtgg |
28275453 |
T |
|
| Q |
258 |
atgaggtcgttgatactattaaaaatgtttcttggctccaaagaaaagagctccttgtctctattatgagtggtttataaacgcttttgattgtatgtgt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275454 |
atgaggtcgttgatactattaaaaatgtttcttggctccaaagaaaagagctccttgtctctattatgagtggtttataaacgcttttgattgtatgtgt |
28275553 |
T |
|
| Q |
358 |
aatttaaagtttttggcatctacttgcacttatattcattaatcaatatattcttc |
413 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275554 |
aatttcaagtttttggcatctacttgcacttatattcattaatcaatatattcttc |
28275609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 27 times since January 2019
Visitors: 5776