View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0788_high_8 (Length: 264)
Name: NF0788_high_8
Description: NF0788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0788_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 32 - 245
Target Start/End: Complemental strand, 8768546 - 8768331
Alignment:
| Q |
32 |
aaactacgacaaatataattttc-tttctcatataaaatnnnnnnntata--attaatagttaattttgtatgagaag-agagattatctataatataca |
127 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8768546 |
aaactacgacaaatataattttcctttctcatataaaataaaataatatataattaatagttaattttgtatgacaaggagagattatctataatataca |
8768447 |
T |
|
| Q |
128 |
tgccggatcatctcttagaaggaaaatgtcgaatccataataattaaatgtccaccctttttataataaaatttttatgtctatcctttatatttagata |
227 |
Q |
| |
|
||||||||||||||||| | ||||||| ||| ||| ||||||| ||||||||||||||| ||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
8768446 |
tgccggatcatctcttaaac--aaaatgtagaacccaaaataattcaatgtccacccttttattaataaattttttatgtctatcctttatatatagata |
8768349 |
T |
|
| Q |
228 |
gcatcatatattattcga |
245 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8768348 |
gcatcatatattattcga |
8768331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6266 times since January 2019
Visitors: 5764