View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0788_low_12 (Length: 348)
Name: NF0788_low_12
Description: NF0788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0788_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 74 - 263
Target Start/End: Complemental strand, 22080501 - 22080312
Alignment:
Q |
74 |
tgagatgaagaaattttaggagaataagcgggatgctgaagctaagctggtagagcttaataacaattatgattaaatggcgaggcttggaagggccccc |
173 |
Q |
|
|
||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22080501 |
tgagaagaagaaagtttaggagaataagcgggatgctgaagctaagctgttagagcttaataacaattatgattaaatggcgaggcttggaagggccccc |
22080402 |
T |
 |
Q |
174 |
aaaatattactgagttacaggaggaggtacaaaatgctaagatgaatgttgttgagaatatagaaaaggggtttgatcgagccaacgatc |
263 |
Q |
|
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
22080401 |
aaagtattactgagttacaggaggaggtacaaaatgctaagatgaatgttgctgagaatatagaaaaggggtttgatcgagccaacgatc |
22080312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 102 times since January 2019
Visitors: 5777