View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0788_low_17 (Length: 301)
Name: NF0788_low_17
Description: NF0788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0788_low_17 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 35805840 - 35806136
Alignment:
Q |
1 |
ttaatttacattaataaattcatatgcaattgcgtggtggagatttatatttatcacaattttgatggtggtggtgtgattttgttgggttgcgattgtt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
T |
35805840 |
ttaatttacattaataaattcatatgcaattgcgtggtggagatttatatttatcacaattttgatggtggtggtatgattttgttgggtgtcgattgtt |
35805939 |
T |
 |
Q |
101 |
ttgtggctaaagtannnnnnnnnnnnaataaaatggattatgacggagttttggttgtggtgttgatgatgaggagcttgtgggtgannnnnnnnnnnnn |
200 |
Q |
|
|
|||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
T |
35805940 |
ttgtggctaaagta-ttttttttttcaatcaaatggactatgacggagttttggttgtggtgttgatgatgaggagtttgcgggtga---tttttgtttt |
35806035 |
T |
 |
Q |
201 |
nnncttcccgttttttgctcatgatgacctcatatttgggtccatcacagccgctgcttactcgcgtcggtttaaggttgtcttcgctttggctcgtggc |
300 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
35806036 |
tttcttcctattttttgctcatgatgacctcatatttgggttcatctcagccgctgcttactcgcgtcggtttaaggttgtcttcgttttggctcgtggc |
35806135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 130 times since January 2019
Visitors: 5777