View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0788_low_20 (Length: 271)
Name: NF0788_low_20
Description: NF0788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0788_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 29 - 250
Target Start/End: Complemental strand, 22429559 - 22429338
Alignment:
Q |
29 |
agatggttgtgtccaaagagaaagaggtgaacgaccattcaccaaccttgccccccaacattaattttggccaattaagtcccttgnnnnnnnnnnnntg |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
22429559 |
agatggttgtgtccaaagagaaagaggtgaacgaccattcaccaaccttgccccccaacattaattttggccaattaagtcccttgcacacacacacatg |
22429460 |
T |
 |
Q |
129 |
tagacacatactatagtacacacgcacgcccacatattatgcaaaaagacactagttataagagactattgtctttattttaattaatttttgaataata |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
22429459 |
tagacacatactatagtacacacgcacgcccacatattatgcaaaaagacactagttataagagactattgtctttattttaattaatttttaaataata |
22429360 |
T |
 |
Q |
229 |
agagactaaatctttgatgatg |
250 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
22429359 |
agagactaaatctttgatgatg |
22429338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 247 times since January 2019
Visitors: 5777