View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0788_low_25 (Length: 252)
Name: NF0788_low_25
Description: NF0788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0788_low_25 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 26585607 - 26585847
Alignment:
| Q |
12 |
caaaatccatgtcaaacaaacttttgtttggtttgctctcctcacaaaatcaccaagttttggagctggtgacaatgatatgggatcagttatgtatggc |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
26585607 |
caaaatccatgttaaacaaacttttgtttggttttctctcctcacaaaatcaccaagttttggagttggtgacaacgatatgggatcagttatgtatggc |
26585706 |
T |
|
| Q |
112 |
ataacaatgttaattactgggtctaagtccgtcatggttataatggaatgaatgagactgaatttgattatagagaaagaattgcaatgggaatttaaga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26585707 |
ataacaatgttaattactgggtctaagtccgtcatggttataatggaatgaatgagattgaagttgattatagagaaagaattgcaatgggaatttaaga |
26585806 |
T |
|
| Q |
212 |
gaaagaatagagcaaagtatgttagttagttacattagtta |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26585807 |
gaaagaatagagcaaagtatgttagttagttacattagtta |
26585847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 26585253 - 26585309
Alignment:
| Q |
12 |
caaaatccatgtcaaacaaacttttgtttggtttgctctcctcacaaaatcaccaag |
68 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
26585253 |
caaaatctatgtcaaacaaactttggtttggtttggcctcctcacaaaatcaccaag |
26585309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 12 - 86
Target Start/End: Original strand, 8288338 - 8288412
Alignment:
| Q |
12 |
caaaatccatgtcaaacaaacttttgtttggtttgctctcctcacaaaatcaccaagttttggagctggtgacaa |
86 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288338 |
caaaatccatgtcaaacaaactttggtttggcttggtctcctcacaaaatcaccaagttttggagctggtgacaa |
8288412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 19828472 - 19828520
Alignment:
| Q |
38 |
tttggtttgctctcctcacaaaatcaccaagttttggagctggtgacaa |
86 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19828472 |
tttggtttggtctcctcacaaaatcaccaagttttggagctggtgacaa |
19828520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 72 times since January 2019
Visitors: 5776