View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0788_low_9 (Length: 392)
Name: NF0788_low_9
Description: NF0788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0788_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 30 - 282
Target Start/End: Complemental strand, 29582155 - 29581903
Alignment:
| Q |
30 |
gatgtatccgttgtgattgttgtccatgttgttgagtagggcataaagttcatcgcctgttggtttgatgccgagggagcggaggagtgccgcgagctcg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29582155 |
gatgtatccgttgtgattgttgtccatgttgttgagtagggcataaagttcatcgcctgttggtttgatgccgagggagcggaggagtgccgcgagctcg |
29582056 |
T |
|
| Q |
130 |
aggtgggttaggctgccgtcggaatccatgtcaaaacgcttgaatatgtcgtttaattgtttgatttgatcatcggtttggagcattgacatggtggtag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29582055 |
aggtgggttaggctgccgtcggaatccatgtcaaaacgcttgaatatgtcgtttaattgtttgatttgatcatcggtttggagcattgacatggtggtag |
29581956 |
T |
|
| Q |
230 |
gttggtgaaggcctaggccttgaggaggagagaaaacttatagataaatcaaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29581955 |
gttggtgaaggcctaggccttgaggaggagagaaaacttatagatagatcaaa |
29581903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 156 times since January 2019
Visitors: 5777