View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0789_high_14 (Length: 251)
Name: NF0789_high_14
Description: NF0789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0789_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 49817279 - 49817540
Alignment:
| Q |
1 |
tgaaccatttgaattctttaaatcatgtgagaatgaaattctaggactgaatcctgggctgtttgtttcactacacacttcaattgccatgctctgtt-- |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49817279 |
tgaaccatttgaattctttaaatcatgtgagaatgaaattctaggactgaatcctgggctgtttgtttcactacacacttcaattgccatgctctgtttc |
49817378 |
T |
 |
| Q |
99 |
-------------------tttgagtgagtgggaaatgttttgaaatttatttatatgttgaaaaggtaaagtaaaggaagtgaaagagaaatgtgttgg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49817379 |
tgaacaggggaactatgtttttgagtgagtgggaaatgttttgaaatttatttatatgttgaaaaggtaaagtaaaggaagtgaaagagaaatgtgttgg |
49817478 |
T |
 |
| Q |
180 |
gaattatggggttgagaagtcagaaattgcagctttattagacttttgtggtatggtctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49817479 |
gaattatggggttgagaagtcagaaattgcagctttattagacttttgtggtatggtgtgtg |
49817540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University