View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0789_high_22 (Length: 205)
Name: NF0789_high_22
Description: NF0789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0789_high_22 |
 |  |
|
| [»] chr3 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 104 - 205
Target Start/End: Complemental strand, 1739092 - 1738991
Alignment:
| Q |
104 |
atatagtaatagaaaaagtttaggaggaatagaactgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaaggcagcttatgat |
203 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1739092 |
atataataatagaaaaagtttaggaggaatagagctgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaagttagcttatgat |
1738993 |
T |
 |
| Q |
204 |
gt |
205 |
Q |
| |
|
|| |
|
|
| T |
1738992 |
gt |
1738991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 112 - 205
Target Start/End: Complemental strand, 1717587 - 1717494
Alignment:
| Q |
112 |
atagaaaaagtttaggaggaatagaactgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaaggcagcttatgatgt |
205 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||| | ||||||||||||| || |||||||||||| |
|
|
| T |
1717587 |
atagaaaaagtttaggaggaatagagctgatgaatgagccactaggtgtcaatctagatagcttgaagaactattacagggaagcttatgatgt |
1717494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 119 - 204
Target Start/End: Complemental strand, 1748932 - 1748847
Alignment:
| Q |
119 |
aagtttaggaggaatagaactgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaaggcagcttatgatg |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1748932 |
aagtttaggaggaatagagctgatgaatgagccacaaggtgtcaatcttgatagtctcaagaagtattacaaggcagcttatgatg |
1748847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 109 - 204
Target Start/End: Complemental strand, 1754258 - 1754163
Alignment:
| Q |
109 |
gtaatagaaaaagtttaggaggaatagaactgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaaggcagcttatgatg |
204 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
1754258 |
gtaatagaccaagtttaggaggaatagagttgatgaatgagccacaaggtgtcaatctagatagcctcaagaaatattacaaggaggcttatgatg |
1754163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University