View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0789_high_7 (Length: 351)
Name: NF0789_high_7
Description: NF0789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0789_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 7331717 - 7332065
Alignment:
Q |
1 |
gtgacttaccaatctggactagaaaaatgttgtcagcctgtcaaatccttccaaactactatgttgtctaatttgaccccatgtatagttctgtccaaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||| |
|
|
T |
7331717 |
gtgacttaccaatctggactagaaaaatgttgtcagcctggaaaatccttccaaactactatgttgtctaagttgaccccatgtatggttttgtccaaaa |
7331816 |
T |
 |
Q |
101 |
at-----------tcatttccatatttacagaaagcagtgagtcggttttttcaaaggggaccgacaaaatatcaacagaagcaactgacagcaagtgct |
189 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7331817 |
attcaccagaaattcatttccatatttacagaaagcagtgagtcggttttttcaaaggggaccgacaaaatatcaacagaagcaactgacagcaagtgct |
7331916 |
T |
 |
Q |
190 |
gattgccttctgtgagaaacacttatgtttccttaaacgaggaaaagagaacaacatggttaaccttgagattt---tcgttgagattcttttctggact |
286 |
Q |
|
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||| |||||| |||| ||||||||||| |
|
|
T |
7331917 |
gattgccttctgcgagaaacacttctgtttccttaaacgaggaaaagagaacaccatggttaacattgagatttatatcgttgggattgttttctggact |
7332016 |
T |
 |
Q |
287 |
acagctgctgcactatccgtgtttgcatttatatcactacgcttggatt |
335 |
Q |
|
|
|| ||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
T |
7332017 |
gcaactgctgcactatctgtgttggcgtttatatcactacgcttggatt |
7332065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University