View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0789_low_17 (Length: 256)
Name: NF0789_low_17
Description: NF0789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0789_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 34139666 - 34139420
Alignment:
| Q |
1 |
gaagatcttccatttccaactgattatgccgaccgatatgtatctgctggaaggtattgtgttgtcacagttctttcatctcagtaactttgcccccttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34139666 |
gaagatcttccatttccaactgattatgctgaccgatatgtttctgctggaaggtattgtgttgtcacagttctttcttctcagtaactttgcccccttc |
34139567 |
T |
|
| Q |
101 |
attgtatatactgcaagtaagctttgtaattaatttaattagtcttcatgtttgtcaattaagttcacnnnnnnnctctgaagttaaaacactatgagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34139566 |
attgtatatactgcaagtaagctttgtaattaatttaattagtcttcatgtttgtcaattaagttcactttttttctctgaagttaaaacactatgagtt |
34139467 |
T |
|
| Q |
201 |
atctgtcacggtttggactcaaaattaaggcatggttggagaataat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34139466 |
atctgtcacggtttggactcaaaattaaggcatggttggagaataat |
34139420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5767 times since January 2019
Visitors: 5759