View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0789_low_24 (Length: 228)

Name: NF0789_low_24
Description: NF0789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0789_low_24
NF0789_low_24
[»] chr1 (1 HSPs)
chr1 (1-124)||(32467291-32467414)


Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 32467291 - 32467414
Alignment:
1 tagtatggaatactgtgattgctgctcaatcttatgttgttgaacgataatgctcatgatggtcgatggaagacatgttgtcagttggagtaagccatca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
32467291 tagtatggaatactgtgattgctgctcaatcttatgttgttgaacgataatgctcatgatggtcgatggaagacatgttgtcagatggagtaagccatca 32467390  T
101 ccaggaagggtaaactgtaatatt 124  Q
     |||||||||||||||||||||||    
32467391 tcaggaagggtaaactgtaatatt 32467414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5182 times since January 2019
Visitors: 5755