View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0789_low_27 (Length: 214)
Name: NF0789_low_27
Description: NF0789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0789_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 32429888 - 32430022
Alignment:
| Q |
1 |
aagtaattgttccttattgtggaaagtttgtcatggtaagctccttactaatgaagaaagaaatggcctctaatagtatttgtatgtgttgcaattatcg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32429888 |
aagtaattgttccttattttggaaagtttgtcatggtaagctccttactaatgaagaaagaaacggcctctaatagtatttgtatgtgttgcaattatcg |
32429987 |
T |
|
| Q |
101 |
tgatgactttattatgtgtgttattcgtgtctgtg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32429988 |
tgatgactttattatgtgtgttattcgtgactgtg |
32430022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6188 times since January 2019
Visitors: 5762