View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0789_low_29 (Length: 205)

Name: NF0789_low_29
Description: NF0789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0789_low_29
NF0789_low_29
[»] chr3 (4 HSPs)
chr3 (104-205)||(1738991-1739092)
chr3 (112-205)||(1717494-1717587)
chr3 (119-204)||(1748847-1748932)
chr3 (109-204)||(1754163-1754258)


Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 104 - 205
Target Start/End: Complemental strand, 1739092 - 1738991
Alignment:
104 atatagtaatagaaaaagtttaggaggaatagaactgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaaggcagcttatgat 203  Q
    ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
1739092 atataataatagaaaaagtttaggaggaatagagctgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaagttagcttatgat 1738993  T
204 gt 205  Q
    ||    
1738992 gt 1738991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 112 - 205
Target Start/End: Complemental strand, 1717587 - 1717494
Alignment:
112 atagaaaaagtttaggaggaatagaactgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaaggcagcttatgatgt 205  Q
    ||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||| | ||||||||||||| || ||||||||||||    
1717587 atagaaaaagtttaggaggaatagagctgatgaatgagccactaggtgtcaatctagatagcttgaagaactattacagggaagcttatgatgt 1717494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 119 - 204
Target Start/End: Complemental strand, 1748932 - 1748847
Alignment:
119 aagtttaggaggaatagaactgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaaggcagcttatgatg 204  Q
    |||||||||||||||||| ||||||||||||||||  ||||||||||  ||||| |||||||| ||||||||||||||||||||||    
1748932 aagtttaggaggaatagagctgatgaatgagccacaaggtgtcaatcttgatagtctcaagaagtattacaaggcagcttatgatg 1748847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 109 - 204
Target Start/End: Complemental strand, 1754258 - 1754163
Alignment:
109 gtaatagaaaaagtttaggaggaatagaactgatgaatgagccacttggtgtcaatcaagatagcctcaagaactattacaaggcagcttatgatg 204  Q
    ||||||||  ||||||||||||||||||  |||||||||||||||  |||||||||| ||||||||||||||| ||||||||||  ||||||||||    
1754258 gtaatagaccaagtttaggaggaatagagttgatgaatgagccacaaggtgtcaatctagatagcctcaagaaatattacaaggaggcttatgatg 1754163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University