View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0789_low_4 (Length: 436)
Name: NF0789_low_4
Description: NF0789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0789_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 133 - 287
Target Start/End: Original strand, 6759618 - 6759772
Alignment:
| Q |
133 |
tacgggtcgtgcatctatcataaattgaagtttgcatttgtgaaagcatgttatactgaggtgaaaattttcggttgggctggatggatgagtaattgac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6759618 |
tacgggtcgtgcatctatcataaattgaagtttgcatttgtgaaagcatggtatactgagttgaaaattttcggttgggctggatggatgagtaattgac |
6759717 |
T |
|
| Q |
233 |
catctctgtatctatgatattgcaataataaattacaatactaacttgtgaaaaa |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6759718 |
catctctgtatctatgatattgcaataataaattacaatactaacttgtgaaaaa |
6759772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 295 - 431
Target Start/End: Original strand, 4224300 - 4224436
Alignment:
| Q |
295 |
gacttagttttttggggggtgtagaaaagagagggttagttggttatgtggatgatgaatattggaatgaaggaattaggggtggtagagtttgtaagga |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4224300 |
gacttagttttttggggggtgtagaaaagagagggttagttggttatgtggatgatgaatattggaatgaaggaattaggggtggtagtgtttgtaagga |
4224399 |
T |
|
| Q |
395 |
aaatgatgtgtatgggctaggggtgatattcttggag |
431 |
Q |
| |
|
||||||||| |||||| |||||||||| || |||||| |
|
|
| T |
4224400 |
aaatgatgtttatgggttaggggtgattttgttggag |
4224436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 21 - 134
Target Start/End: Original strand, 6759462 - 6759575
Alignment:
| Q |
21 |
acatcatcattgctgcagatatcatagtcgcttaacattgtgacaacaaagtatacatagtgaaaaatttcaatttcggctcaatgtataagtaactaaa |
120 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
6759462 |
acatcatcattgctgcagatttcatagtcgcttaacattgtgacaacaaagtatacatagtgaaaattttcaagttcggctcaatgtataagtaactaaa |
6759561 |
T |
|
| Q |
121 |
catggctggattta |
134 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6759562 |
catggctggattta |
6759575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5037 times since January 2019
Visitors: 5753