View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790-Insertion-1 (Length: 331)
Name: NF0790-Insertion-1
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0790-Insertion-1 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 331
Target Start/End: Original strand, 2347499 - 2347839
Alignment:
| Q |
8 |
aatgtcacaacaatctacaggtgggttctgaagttcaagctgatttagttcaggattgatcaaaacatactcagtgttcattgaaagaaactttttgatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2347499 |
aatgtcacaacaatctacaggtgggttctgaagttcaagctgatttagttcaggattgatcaaaacatactcagtgttcattgaaagaaactttttgatg |
2347598 |
T |
 |
| Q |
108 |
tagcgcaaaatcctacaaatagacgagaagctaggacgctgagacggatcagtttgccaacattttttgatc-aactcacaagatattttggcgaacgat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2347599 |
tagcgcaaaatcctacaaatagacgagaaactaggacgctgagacggatcagtttgccaacattttttgatcaaactcacaagatattttggcgaacgat |
2347698 |
T |
 |
| Q |
207 |
atgg-aacaa--gtctctct-ctgc-ttgata-tttggt--ggtctaatcc--tgaagatga-tgt-ctc--aagga--tttccctggtcacaactcaaa |
290 |
Q |
| |
|
|||| ||||| |||||||| |||| |||||| |||||| | |||||||| ||||||||| ||| ||| ||||| |||||||| |||||||||| |
|
|
| T |
2347699 |
atggaaacaaaggtctctctcctgctttgatattttggttggttctaatcccttgaagatgattgtcctcaaaaggaattttccctgtcaacaactcaaa |
2347798 |
T |
 |
| Q |
291 |
acatatcataaccaagctatatgcatcggctttctctgagt |
331 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
2347799 |
acatatcataccaaagctatatgcatcggctttctctgagt |
2347839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University