View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790-Insertion-3 (Length: 263)
Name: NF0790-Insertion-3
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0790-Insertion-3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 6 - 253
Target Start/End: Complemental strand, 3125403 - 3125156
Alignment:
Q |
6 |
catttctttcaaagcatgaaggaagattatggcttggagccttcaatggatcactatagtgctgtggttgatctccttggtcgtgccggaaagttacatg |
105 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
3125403 |
catttctttcaaagcatgaaggaagattatggcctggagccttcaatggatcactatagtgctgtggtcgatctccttggtcgtgccggaaagttacatg |
3125304 |
T |
 |
Q |
106 |
gtgcttggaatttaattgaagagatgcctatcaaaccagggattaccgttttaggtgcaatgctcggtgcttgcaaaattcataaaaatgtcgaattggg |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3125303 |
gtgcttggaatttaattgaagagatgcctatcaaaccagggattaccgttttaggtgcaatgctcggtgcttgcaaaattcataaaaatgtcgaattggg |
3125204 |
T |
 |
Q |
206 |
cgaaaaagcagcagacaaactatttgagttagatccagatgagggtgg |
253 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3125203 |
cgaaaaagcagcagacaaactatttgagttagatccagatgagggtgg |
3125156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 3129789 - 3130022
Alignment:
Q |
20 |
catgaaggaagattatggcttggagccttcaatggatcactatagtgctgtggttgatctccttggtcgtgccggaaagttacatggtgcttggaattta |
119 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||| || ||||||||||| ||| || ||| ||||||||| || |
|
|
T |
3129789 |
catgaaggaaggttatggcttggagccttcaatggatcactatggtgccatggttgatcttctcggtcgtgccggcaagctagatgatgcttggaagttt |
3129888 |
T |
 |
Q |
120 |
attgaagagatgcctatcaaaccagggattaccgttttaggtgcaatgctcggtgcttgcaaaattcataaaaatgtcgaattgggcgaaaaagcagcag |
219 |
Q |
|
|
||| | |||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||| |||||||| |||| |
|
|
T |
3129889 |
attcacgagatgcccatcaaaccggggattaccgttttaggtgcaatgctcggtgcttgtaaaattcacaaaaacatcgaattgggtgaaaaagctgcag |
3129988 |
T |
 |
Q |
220 |
acaaactatttgagttagatccagatgagggtgg |
253 |
Q |
|
|
||| | | || ||||| ||||||||||||||||| |
|
|
T |
3129989 |
acagattgttcgagttggatccagatgagggtgg |
3130022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University