View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790-Insertion-6 (Length: 144)
Name: NF0790-Insertion-6
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0790-Insertion-6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 7 - 144
Target Start/End: Complemental strand, 7122579 - 7122442
Alignment:
| Q |
7 |
aaatccaacgctgtatattgcttttcctagggttcccattttcgatggagaattcgaatttggatttccttaagcgatttagaataatttctccgtggtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7122579 |
aaatccaacgctgtatattgcttttcctagggttcccattttcgatggagaattcgaatttggatttccttaagcgatttagaagaatttctccgtggtg |
7122480 |
T |
 |
| Q |
107 |
ttatggaatatgtgaagaaggaaaatggtggtgagtgg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7122479 |
ttatggaatatgtgaagaaggaaaatggtggtgagtgg |
7122442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University