View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790-Insertion-7 (Length: 101)
Name: NF0790-Insertion-7
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0790-Insertion-7 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 43; Significance: 5e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 59 - 101
Target Start/End: Complemental strand, 24538148 - 24538106
Alignment:
Q |
59 |
aaaaaataaggtagagaagctttattgatgaaacctctcttca |
101 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24538148 |
aaaaaataaggtagagaagctttattgatgaaacctctcttca |
24538106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4781 times since January 2019
Visitors: 5752