View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0790_high_10 (Length: 323)

Name: NF0790_high_10
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0790_high_10
NF0790_high_10
[»] chr6 (3 HSPs)
chr6 (1-79)||(13204914-13204992)
chr6 (1-136)||(13178837-13178968)
chr6 (202-233)||(13203911-13203942)
[»] scaffold0024 (1 HSPs)
scaffold0024 (26-72)||(154202-154248)


Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 13204914 - 13204992
Alignment:
1 ttgtttcatgattattaaggctttccttcatgtatgcaattcaaactaatgatgataggagcaaaaatgtgttatattt 79  Q
    ||||||||||||||||||||||| |||||| |||| |||||||||||||||||||||||||||||||||| ||||||||    
13204914 ttgtttcatgattattaaggcttgccttcaagtattcaattcaaactaatgatgataggagcaaaaatgttttatattt 13204992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 13178837 - 13178968
Alignment:
1 ttgtttcatgattattaaggctttccttcatgtatgcaattcaaactaatgatgataggagcaaaaatgtgttatatttttaatannnnnnnnatatact 100  Q
    ||||||| |||||||||||||||  | |||||||||||||||||||||||||||||||||||||||| || |||||  |||||||        |||||||    
13178837 ttgtttcgtgattattaaggcttgtcctcatgtatgcaattcaaactaatgatgataggagcaaaaaagttttata--tttaata--ttttgaatatact 13178932  T
101 ataagagtttgttgtagattgaatccggggaacatg 136  Q
    ||| ||||||||||||||||||||  ||||||||||    
13178933 ataggagtttgttgtagattgaattaggggaacatg 13178968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 202 - 233
Target Start/End: Original strand, 13203911 - 13203942
Alignment:
202 aacttcttaaatgtttatgtccaccattgagt 233  Q
    ||||||||||||||||||||||||||||||||    
13203911 aacttcttaaatgtttatgtccaccattgagt 13203942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 72
Target Start/End: Original strand, 154202 - 154248
Alignment:
26 cttcatgtatgcaattcaaactaatgatgataggagcaaaaatgtgt 72  Q
    ||||||||||  |||||||||||||||||| || |||||||||||||    
154202 cttcatgtatataattcaaactaatgatgacagaagcaaaaatgtgt 154248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University