View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790_high_12 (Length: 292)
Name: NF0790_high_12
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0790_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 71 - 270
Target Start/End: Original strand, 50648558 - 50648757
Alignment:
Q |
71 |
tgtttaaccaaagaagagagtctcatttctttctcttctctttctcatcccaaagatacaatcaactttgggtaaccataatttgttatttttgttaaaa |
170 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50648558 |
tgtttaaccaaagaagagagtctcatttctttctcttctctttctcatcccaaagatacagtcaactttgggtaaccataatttgttatttttgttaaaa |
50648657 |
T |
 |
Q |
171 |
tcaaatttgactggatnnnnnnnntgcgtggatggctcaaatcctcccaagctccccgtgcagtaaattttaaaacatacgacatagaccacatattcat |
270 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
50648658 |
tcaaatttgactggataaaaaaaatgcgtggatggctcaaatcctcccaagctccccgtgcagtaaattttaaaacagacgacatagaccacatattcat |
50648757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6816 times since January 2019
Visitors: 5772