View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0790_high_16 (Length: 251)

Name: NF0790_high_16
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0790_high_16
NF0790_high_16
[»] scaffold0092 (1 HSPs)
scaffold0092 (23-251)||(22132-22360)


Alignment Details
Target: scaffold0092 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0092
Description:

Target: scaffold0092; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 23 - 251
Target Start/End: Original strand, 22132 - 22360
Alignment:
23 attgatggtaactataatccagatggagctcagaagtggctaaaagatgagatatcaattgtttgaaagatcgataggtacacctaggaacatttatatt 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
22132 attgatggtaactataatccagatggagctcagaagtggctaaaagatgagatatcaattgtgtgaaagatcgataggtacacctaggaacatttatatt 22231  T
123 atatgaaaaggttgaacattggtggaataatgcttggaaggacaacgagttgagatcatgtcaactgttttttgggataagtttctgattaattacttcc 222  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22232 atatgaaaaggttgaacattggttgaataatgcttggaaggacaacgagttgagatcatgtcaactgttttttgggataagtttctgattaattacttcc 22331  T
223 ctggacagatttacaaccgaacaagagca 251  Q
    |||||||||||||||||||||||||||||    
22332 ctggacagatttacaaccgaacaagagca 22360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University