View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790_high_17 (Length: 236)
Name: NF0790_high_17
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0790_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 14 - 129
Target Start/End: Original strand, 26529953 - 26530068
Alignment:
Q |
14 |
atatatatatgaaaatacaaataaccccatgtgcatcaaaccaaataaataactgtttgcatgtgattgggcgtttctacacgatatgaagatgcaaatc |
113 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
26529953 |
atatatatatgaaaatacaaataaccccatgtgcatcaaaccaaataaataactgtttgcatgtgattgggcgtttctacaggatatgaagatgcaaatc |
26530052 |
T |
 |
Q |
114 |
atctcaaatacctacc |
129 |
Q |
|
|
|||||||||||||||| |
|
|
T |
26530053 |
atctcaaatacctacc |
26530068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6683 times since January 2019
Visitors: 5770