View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790_low_21 (Length: 350)
Name: NF0790_low_21
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0790_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 92 - 337
Target Start/End: Original strand, 35374560 - 35374805
Alignment:
| Q |
92 |
acttatccactggattctaactcgccttcaaacaatgctgataaggcacgaagatacgaatacctcatgtcactattctaacgaccaattgcaaacacat |
191 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35374560 |
acttatccactggattctaactagccttcaaacaatgctgataaggcacgaagatacgaatacctcacgtcactattctaacgaccaattgcaaacacat |
35374659 |
T |
|
| Q |
192 |
gtcgtccacaacttagacgagttggtcataaacaccatccccttctctgtctacactgctaagtatgcaaacgaagaatctctacgtgattgtgttattt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35374660 |
gtcgtccacaacttagacgagttggtcagaaacaccatccccttctctgtctacactgctaagtatgcaaacgaagaatctctacgtgattgtgttattt |
35374759 |
T |
|
| Q |
292 |
gcttggatgagtttgaagacaataatgacattggtacactccctct |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35374760 |
gcttggatgagtttgaagacaataatgacattggtacactccctct |
35374805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 337
Target Start/End: Original strand, 35380949 - 35381059
Alignment:
| Q |
227 |
catccccttctctgtctacactgctaagtatgcaaacgaagaatctctacgtgattgtgttatttgcttggatgagtttgaagacaataatgacattggt |
326 |
Q |
| |
|
||||| || ||| ||||||| ||||| |||||| | ||||||| || |||||||||||||||||||||| |||| |||||||||||| || |||||| |
|
|
| T |
35380949 |
catcctctcctccgtctacaacgctaaatatgcacaagaagaatttcaacgtgattgtgttatttgcttgaatgaatttgaagacaatgataccattgga |
35381048 |
T |
|
| Q |
327 |
acactccctct |
337 |
Q |
| |
|
|| |||||||| |
|
|
| T |
35381049 |
acgctccctct |
35381059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 169 - 292
Target Start/End: Original strand, 30811863 - 30811986
Alignment:
| Q |
169 |
ctaacgaccaattgcaaacacatgtcgtccacaacttagacgagttggtcataaacaccatccccttctctgtctacactgctaagtatgcaaacgaaga |
268 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||| |||| |
|
|
| T |
30811863 |
ctaacgaccaactgcaaacacatgtcgttcataacttagacgagttggtcataaataccatctccttctccatctacaccgctaagtatgcaaaagaagc |
30811962 |
T |
|
| Q |
269 |
atctctacgtgattgtgttatttg |
292 |
Q |
| |
|
|| | |||| | ||||||||||| |
|
|
| T |
30811963 |
atttgcacgttactgtgttatttg |
30811986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7057 times since January 2019
Visitors: 5773