View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0790_low_25 (Length: 337)
Name: NF0790_low_25
Description: NF0790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0790_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 97 - 259
Target Start/End: Original strand, 9518134 - 9518296
Alignment:
| Q |
97 |
tttagtttgttttggataagatttgttaggttgttacaagaggtattccccatagttgcacccaaactcttcgcttcttggccaccatatgaggatacca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9518134 |
tttagtttgttttggataagatttgttaggttgttacaagaggtactccccatagttgcacccaaactcttctcttcttggccaccatatgaggatacca |
9518233 |
T |
 |
| Q |
197 |
tttattcaccttgaagaacagagcctcccaccactccttcctctcattctgcgcctttgctac |
259 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
9518234 |
tgtattcaccttgaagaacagagcctcccaccactccttcctctcattccgcgccttttctac |
9518296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 97 - 138
Target Start/End: Original strand, 5247160 - 5247200
Alignment:
| Q |
97 |
tttagtttgttttggataagatttgttaggttgttacaagag |
138 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5247160 |
tttagtttgttttggataag-tttgttaggttgttacaagag |
5247200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University